شرايط کرايو در دماي -80ْ:
نگهداري طولاني مدت باکتري ها اين امکان را مي‌دهد که کليه سويه‌هاي ميکروبي اعم از هوازي و بي هوازي، ماه‏ها و حتي سال‏ها نگهداري شوند(Read, et al, 1998). چون تکرار کردن کشت‏ها و پاساژ دادن آنها باعث ضعيف شدن سويه‏ها مي‏شود و همچنين به منظور جلوگيري از آلودگي، مي‌توان با استفاده از کرايو تيوپ‏ها مقداري از نمونه‏ها در دماي منفي 80 درجه سانتي گراد، فريز کرد و در صورت نياز آنها را براي کشت مجدد و تازه مورد استفاده قرار داد. براي اين کار، مقدار 5 لوپ پر از کشت 24 ساعته در کرايو تيوپ مخلوط شد و در فريزر 80 -درجه جهت استفاده‌هاي بعدي نگهداري گرديد. اين روند در زير هود و کنار شعله انجام شد .(San Martin, 2008)
3-9- استخراج DNA
استخراج، روشي روتين جهت جمع‏آوريDNA براي آناليز مولکوليمي‌باشد.
3-9-1-استخراج DNA به روش جوشاندن:
مقدار 500 ميکروليتر آب مقطر به Pellet سلولي اضافه کرده و با پيپتاژ کردن يا ميکس کردن، سوسپانسيون يکنواختي ساخته شد. ميکروتيوپ به مدت 15 دقيقه در دماي 95 درجه قرار داده شد. (لازم به ذکر است که درپوش ميکروتيوپ بايد با استفاده از يک سوزن سوراخ شود تا در زمان جوشيدن، درپوش باز نشده و محتويات داخل آن به بيرون پرتاپ نگردد.)در مرحله بعد، بلافاصله ميکروتيوپ حاوي نمونه‏ها را روي يخ قرار داديم. بعد از آن ميکروتيوپ به مدت 3 دقيقه در 12000 rpmسانتريفيوژ شد. سپس مقدار 100 ميکروليتر از مايع رويي با دقت جدا شده و در يک ميکروتيوپ جديد که با اطلاعات لازم ليبل دار شده است، ريخته شد. ميکروتيوپ‏ها در دماي 20- درجه سانتي گراد نگهداري مي‌شوند.
3-10- بررسي کيفيت و کميت DNAاستخراج شده:
پس از استخراج، DNA به کمک دستگاه اسپکتروفتومتر مورد بررسي قرار گرفت.
1-صفر کردن دستگاه: داخل يک کووت29 تميز، 2 ? از همان بافر شستشو که براي رقيق کردن به کار رفت ريخته شد. دستگاه روي DNA دو رشته‏اي30و طول موج 260 نانومتر تنظيم شد. با استفاده از کليد Blank دستگاه صفر شد. (ما چون از آب مقطر استفاده کرديم دستگاه را باآب مقطر صفر کرديم. )
2-کووت حاوي محلول در دستگاه قرار داده شد. بااستفاده از کليد Sample، محاسبات مربوط به تعيين غلظت و درجه خلوص به صورت اتوماتيک به وسيله دستگاه انجام شده و عدد نهايي ارائه گرديد.
3-11- راه اندازي و انجام PCR:
PCR، روشي in vitroاست که سبب تکثير يک توالي معين از DNA دو رشته‏اي با استفاده از پرايمر‌هاي اليگو نوکلئوتيدي مي‏شود.اين روش توسط Kary Mullis در سال 1983 ابداع شد. در اين تکنيک اصول همانند سازي DNA در داخل سلول زنده تقليد و تکرار مي‏شود و بااستفاده از ترکيبات ضروري موجود در يک سيستم بافري، ناحيه‏اي از يک مولکولDNA الگو توسط آنزيم تکثير مي‏شود. پرايمرها قطعات اليگو نوکلئوتيدي مکمل توالي مورد نظر هستند و ناحيه الگوبرداري را مشخص مي‌کنند. (Kennedy, 2011)
هر سيکل PCR شامل چند مرحله است:
مرحله شروع:31
دماي بالا به طور معمول 94-98 به مدت 1 تا 9 دقيقه، براي فعال کردن آنزيم مقاوم به دماي بالاي Taq پليمراز
مرحله واسرشت:32
باز شدن دو رشته الگو به واسطه حرارت، دما معمولاً 93-95 درجه سانتيگراد و زمان 20 تا 30 ثانيه مي‌باشد.
مرحله اتصال:33
در اين مرحله پرايمرها توالي مکمل را روي رشته الگو شناسايي نموده و به آن وصل مي‌شوند. تنظيم دماي اين مرحله بسيار مهم است. دماي ذوب TM))، دمايي است که براي شکستن هر باند AT دو درجه و براي شکستن هر باند GC چهار درجه حرارت لازم است. (فرمول 3-1)
فرمول(3-1): TM=2(A+T)+4(G+C)
مرحله طويل شدن:
آنزيم Taq پليمراز با افزودن داکسي نوکلئوتيدها (dNTPs) به گروه‌هاي3?-OH پرايمرها، سنتز رشته جديد را شروع نموده و مولکول دو رشته‏اي جديد توليد مي‏شود. دماي بهينه براي فعاليت آنزيم Taq پليمراز معمولاً 72 تا 75 درجه سانتي گراد است. تمامي ‌اين مراحل توسط دستگاه ترموسايکلر که قابل برنامه ريزي است انجام مي‏شود. (Kennedy, 2011)
3-12- واکنشPCR
مواد مورد نياز:
1)Taqپليمراز:
يک آنزيمDNA پليمراز مقاوم به حرارت است که از يک باکتري به نام ترموس اکواتيکوس جدا شده است. داراي فعاليت پليمرازي (اگزونوکلئازي) 5 ?به 3?است. ولي فاقد فعاليت اگزونوکلئازي 3?به 5?است. در نتيجه نميتواند اشتباهات را تصحيح34 نمايد. ،PH،اپتيمم براي فعاليت آن حدود 9و نيمه عمر آن در حرارت 95درجه، 40 دقيقه است.
2)دزوکسي نوکلئوتيد‏ها (dNTPs):
شاملdTTP، dGTP، dCTP، dATP به طور مساوي است.
3) بافرهاي PCR :
اجزا بافر مورد استفاده در مورد ساير پليمرازهاي مقاوم به حرارت متفاوت است، لذا عموما بافر 10X همراه با آنزيم مربوطه مي‌باشد.
4)کاتيون‌هاي دوظرفيتي:
کاتيون دو ظرفيتي معمول در طي واکنش PCR، Mg2+ مي‌باشد که در مرحله اتصال پرايمر با تثبيت بر هم کنش پرايمر-DNA اهميت دارد. و ديگر اهميت آن ايجاد ثبات در اتصال آنزيم پليمراز به کمپلکس پرايمر- DNAمي‌باشد.
5)پرايمرها:
اليگونوکلئوتيدهايي به طول 15 تا 30 نوکلئوتيد مي‌باشند که اصلي ترين عامل اختصاصي شدن PCR هستند.
6)الگو:
توالي هدف مي‌باشد که يا به صورت تک رشته و يا دو رشته‏اي است.
موارد 1 تا 4 به نسبت‌هاي مناسب با هم مخلوط شده‏اند و محلولي حاصل شده است که 2X Master Mix ناميده مي‏شود. براي واکنش‌هاي PCR اين Master Mix بايد به صورت1X استفاده شود.
3-12-1-شرايط و مواد مورد استفاده در واکنش PCR:
ما در اين پژوهش از 2X PCR Master Mix که از شرکت ويراژن خريداري کرديم استفاده کرديم. سپس از پرايمر Forwardو Reverse به کار رفت. و در نهايت Template DNA و باDDW، به حجم 25 l? ميرسانيم. سپس نمونه‏ها را درون دستگاه PCR گذاشته و برنامه‏ي آنها را تنظيم مي‌کنيم.
قابل ذکر مي‌باشد به همراه نمونه ها از يک نمونه سويه استاندارد هموفيلوس آنفلوانزاNTHI با (PTCC:1766) و يا (ATCC: 49766 ) به عنوان کنترل مثبت استفاده شد. و همين طور به جاي Template DNA از آب مقطر در يک اپندورف به عنوان کنترل منفي استفاده شد.
جدول3-1- مواد تشکيل دهنده و مقدار حجم آنها براي PCRازompP2
volume ( ?l)
PCR reaction components
12. 5 ?l
2X PCR Master Mix
0. 5 ?l
Forward primer
0. 5 ?l
Reverse primer
2 ?l
Template DNA
9. 5 ?l
DDW

به علت حساسيت آنزيمTaq پليمراز همه‌ي مراحل محلول‌سازي PCR بايد روي يخ انجام گيرد. و همچنين ميکروتيوپ‌ها35در مراحل مختلف انجام کار، به صورت کوتاه ورتکس36 شوند تا تمام مواد به خوبي با هم ترکيب شوند. در اخر همه‏ي ميکروتيوپ‌ها را بايد اسپين37 کرد و درون دستگاه ترموسايکلر38 قرار داد. (شکل3-3)

شکل 3-3- دستگاه ترموسايکلر
جدول 3-2- برنامه PCR براي تکثير ژن ompP2
برنامه PCR
تعدادسيکل
زمان
درجه حرارت
مرحله
2
5min
C 94o
Initial Denaturation
1

25
1sec
94oC
Denaturation
Annealing
Extension

2

1sec
60oC

1sec
72oC

1
10min
72oC
Final Extension
3
توالي پرايمرهاي مورد استفاده در اين بخش مطالعه بااستفاده از نرم افزار Gen Runner و ساير نرم افزارهاي موجود در اينترنت طراحي گرديده و از طريق سايت NCBI. nlm. nih. gov/BLAST ، BLAST شد. و به شرکت تکاپوزيست جهت طراحي ارسال شد.
جدول3-3- توالي پرايمرهاي مورد استفاده براي ompP2
منابع
برنامه مورده استفاده
اندازه محصول PCR
توالي پرايمر (5?-3?)
نام پرايمر
ژن
رديف
This study
OmpP2
1173b
AACAACGAAGGGACTAAAGTAGAATTAGGC
CGCGTAAACCTACACCCACTGATTTTTC
F
R
OmpP2
1

3-13- الکتروفورز محصول PCR:
3-13-1- مواد و وسايل مورد نياز:
* تانک الکتروفورز(Electrophoresis tank)
* منبع تغذيه الکتريکي(power supply)
* اگارز(Agarose)
* محلول0. 5xTris-Hcl Boric Acid EDTA)TBE)
* دستگاه GelDoc
3-13-2- نحوه تهيه ژل اگارز و انجام الکتروفورز:
به ميزان لازم پودر اگارز را با (0. 5X )TBE در داخل بشر مخلوط گرديد. سپس اين مخلوط در مايکروويو قرار داده شد تا محلول جوشيده و شفاف شود. سپس اين مايع را درون کستي ميريزيم که از قبل درون آن شانه قرار داده ايم مي‌ريزيم. پس از گذشت مدت زمان لازم (حدود 15 دقيقه) ژل بسته شده و کاملاً سفت شد، شانه را به آرامي‌، به طوري که چاهک‏ها پاره نشوند از ژل خارج مي‌کنيم و ژل را به تانک حاوي بافر TBE منتقل مي‌کنيم (; Larson et al, 1986 Janson et al, 1993). سپس محصولات PCR و نمونه کنترل مثبت و منفي و DNAمارکر، را بر روي ژل الکتروفورز ران مي‌کنيم. وقتي رنگ آبي (مواد درون چاهک ها) به انتهاي ژل رسيد، جريان برق را قطع کرده و ژل را به مدت 20 دقيقه درون اتيديوم برمايد قرار داده پس از آن درون ظرف آب به مدت 20 دقيقه قرار مي‌دهيم تااز غلظت ماده اتيديوم برومايد کم شود. زيرا اتيديوم يک ماده فوق العاده سمي‌ و سرطان زا است. پس از آن ژل را درون دستگاه GelDoc قرار داده، و از آن در زير نور UV عکس تهيه مي‌کنيم. (Alrawi, 2002)

شکل 3-4- دستگاهالکتروفورز
3-14- تفسير ژل الکتروفورز
با توجه به باند‌هاي مشاهده شده، حضور يا فقدان ژن‌هاي مورد نظر در هر يک از نمونه‏ها در قياس با مارکر تفسير شد و از طرفي با توجه به عدم تشکيل باند در کنترل منفي، عدم آلودگي نمونه‏ها تائيد شد. (Prasadarao et al, 1999)
3-15- RFLP
اين تکنيک کاربرد‌هاي بسياري دارد از جمله تشخيص پلي مورفيسم قطعات PCR شده با يک جفت پرايمر يکسان. هر يک از آنزيم‌هاي محدودالاثر39 روي توالي‌هايDNA داراي سايت يک سايت برش منحصر به فرد است. چنانچه دو قطعه با وزن مولکولي يکسان که از استخراج DNA حاصل شده است وجود داشته باشد، بايد آنزيم الگو‌هاي يکسان بررشي ايجاد نمايد. اما اگر الگو‌هاي حاصل از برش متفاوت باشد، نشان دهنده وقوع جهش در توالي DNAدر مکانهاي برش آنزيم مي‌باشد. در نتيجه عملکرد آنزيم‌هاي محدودالاثر روي آنها الگوهاي متفاوتي روي ژل الکتروفورز نشان مي‌دهد.
هدف از انجام اين تکنيک صرفا براي بررسي پلي مورفيسم باندهايDNA با وزن مولکولي يکسان PCR شده ژن ompP2 مي‌باشد.
3-15-1- استخراج باند اصلي از روي ژل اگارز
به اين علت که ما نتوانستيم در مرحلهPCR کليه باند‌هاي غير اختصاصي را حذف کنيم و اين باند‏ها در مرحله بعدي که تکنيک RFLP مي‌باشد براي ما مشکل ساز مي‌باشد. محصول PCR را بر روي ژل ران مي‌کنيم سپس باند اصلي را که باندbp 1173مي‌باشد را بريده ودرون اپندورف انداخته و بااستفاده از کيت استخراج از روش ژل DNA ‏ها رااز ژل جدا مي‌کنيم. تا فقط بر روي باند اصلي آنزيم محدودالاثر برش ايجاد نمايد.
ازکيت استخراج از روي ژل شرکت(Feldon )استفاده شد.
3-15-2- بررسي غلظت محصولات تخليص شده توسط دستگاه نانودراپ40:
توسط دستگاه نانودراپ غلظت محصولات تخليص شده PCR اندازه گيري شد. همچنين با استفاده از نانودراپ مقدار ناخالصي ناشي از حضور پروتئين و ياRNA در محلول را مي‌توان تعيين نمود. با استفاده از جذب نوري که در 280 نانومتر اندازه گيري مي‏شود و نسبت A260 به A280 محاسبه مي‏شود. در نمونه خالص اين نسبت بايد عددي بين 1. 5 تا 1. 8 باشد، هر چه نسبت محاسبه شده کمتر از اين باشد نشان دهنده آلودگي با پروتئين است و هر چقدر بيشتر باشد، آلودگي باRNA است.

3-16- مواد و وسايل لازمبراي RFLP:
* محصول PCR ژن ompP2
* آنزيم محدودالاثرAlu 1
* بافر آنزيم محدودالاثر
* اپندورف
* سمپلر و سر سمپلر
*

دسته بندی : No category

دیدگاهتان را بنویسید